To Australians in the know, Prof. Ed Holmes is known as 'sweaty Eddie.'
Sir was on TV multiple times in 2020 discussing the origins of covid, looking like someone was holding a gun to his head off screen sweating profusely. It's not about your emails, and it is definitely not about science. It's about the US DOD, the ADF, WHO and the CCP. He has been given his instructions. Tread lightly.
Edit: Hope that answers your question about why he told you to FO and why no one in China will contact you.
Thank you for this very important work! Can you lay out, perhaps here or perhaps in an article of its own, a walk through for lay people on this issue? Have you done that in a past piece? Similarly, can you lay out the scenario of what the assembly assembled, if it was NOT a new virus? Another questions, the CEO of Illumina is on record saying "his team" was flown into China to do the first sequence. Thoughts on that?
What if this sequence can be created in people by an external delivery vector, for example via air, food, water, or EMF?
Combine this with using lower or higher PCR-cycles, and it would be trivial to dial up or down the number of positive PCR-cases, according to the need.
I recently looked at the mouse study they did with mutated mice that express ace2. They used stock covid to infect them. I guess you'd like to see that repeated with a synthetic version? I'd like to know what was in the 'stock covid' they used. What is depressing about that study is they mention these mutated mice could be used to assess early treatment of antivirals. I'm not sure such studies were ever done...not that I'd know how to search for them.
If this sequence only exists in silco, does it have to make sense? I have yet to see any compelling evidence sars-cov2 actually exists, and having just a genomic sequence really proves nothing IMO. These liars can take any old snippets from GenBank or wherever, combine them in silico, and claim it is this or that, but without an actual sample from an infected patient, there is no proof of this alleged virus.
I'm not sure who the man is, or when this event was, but I have a copy of a video clip from some WEF conference and the exact quote from this man is:
'Moderna has never had a live virus in their sight, it was all a software problem'.
And many others have publicly stated similar. I'm not sure how many of these people can keep saying they never had an actual virus before people start believing that they never had an actual virus.
1. You wrote: "Even when trimming off the leading three or four nucleotides from the reads, Megahit still assembles de-novo the head with two extra G bases at the head!"
However I was able to get rid of the two extra G bases when I trimmed the reads with `fastp -f 5 -t 5`, which removes the first 5 and last 5 bases from both forward and reverse reads. Then my longest MEGAHIT contig was 29,870 bases long, and it was otherwise identical to Wuhan-Hu-1 except it was missing the entire poly(A) tail.
There's 25 forward reads which match the first 20 bases of Wuhan-Hu-1 but with two extra G bases added to the start: `seqkit locate -p GGATTAAAGGTTTATACCTTCC SRR10971381_1.fastq`. But in all reads except a single read, the match is on the minus strand so the extra G bases at the start are actually extra C bases at the end of the read. (The forward reads are sense for cDNA and therefore antisense for RNA, so they're what people would intuitively think of as the reverse reads.)
2. You wrote: "No one, to this date, was able to perfectly reproduce MN908947.3 with Megahit or any other assembler, even when trimming the alleged adaptors, we still end up with two (or three) leading G's and a missing tail." But I figured out how to get rid of the leading G bases. And the full poly(A) tail is not included in the metagenomic reads, and Wu et al. wrote that they sequenced the ends of the genome with RACE (rapid amplification of cDNA ends).
Three years ago when the WIV published the second version of RaTG13 which had an extra 15 bases inserted to the 5' end, Steven Quay was saying that that the genome was somehow fake because the extra 15 bases were not included in the metagenomic reads at the SRA (https://twitter.com/quay_dr/status/1318041151211884552). However next year the RACE sequences of RaTG13 were published at the SRA, and they included the extra 15 bases that were missing from the metagenomic reads (https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=606165). So the reason why the genome of RaTG13 was updated may have been that the ends of the genome were sequenced with RACE, and the current version of RaTG13 cannot be reproduced by assembling the original metagenomic reads either.
3. You wrote: "Also, one can tell that the adaptors were probably trimmed, from the way that there are several reads which match the Illumina TruSeq single index adaptors apart from one or two errors. So the errors probably prevented the adaptors from getting trimmed."
More specifically you can find a couple of those reads like this: `printf %s\\n \>adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \>adapter2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT>adapter.fa;bowtie2-build adapter.fa{};bowtie2 -p4 --local --no-unal -x adapter.fa <(seqkit head -n100000 SRR10971381_1.fastq)|grep -v ^@|cut -f1,10|seqkit tab2fx|cat - adapter.fa|mafft --clustalout -`.
4. In your screenshot of the nanopore reads, the reason why the reads have a bunch of N bases and no T bases is that you didn't replace U bases with T bases (for example by running `seqkit seq --rna2dna`). And I don't know why, but a bunch of your reads seem to match the reference but their alignment is just off by about 1-20 bases. The same thing didn't happen to me when I aligned the reads with minimap2: `minimap2 -a --sam-hit-only sars2.fa <(seqkit seq --rna2dna VeroInf24h.all.fastq.zst)|samtools sort -@2 ->nano.bam`.
5. Fast Eddie wrote: "As for the publishing unfiltered reads, there are important ethical issues about realising human DNA. Not my call to make." And in another email he wrote: "Can I also say that I am completely against the raw reads being published as this would be totally unethical. The majority of these reads would be human DNA and it would be a serious breach of ethics for these to be published without the consent of the patient in question, particularly the identity of that patient is now widely known."
Last year some no-virus people were wondering how come half of the reads consisted of only N bases, but it's probably because human reads were masked like Eddie said. The SRA's website says: "Human metagenomic studies may contain human sequences and require that the donor provide consent to archive their data in an unprotected database. If you would like to archive human metagenomic sequences in the public SRA database please contact the SRA and we will screen and remove human sequence contaminants from your submission." (https://www.ncbi.nlm.nih.gov/sra/docs/submit/) The NCBI has a tool called sra-human-scrubber which is used to mask human reads with N bases in SRA submissions (https://ncbiinsights.ncbi.nlm.nih.gov/2023/02/02/scrubbing-human-sequences-sra-submissions/).
Wu et al. also wrote that they had a total of 56,565,928 reads out of which 23,712,657 were non-human reads.
6. You wrote: "How many virions were in the original sample? Surely, if the patient should have died from it, it must've been thousands or even more?" But I don't think the patient in the Wu et al. paper died from COVID, or at least the paper didn't say that he died, and he was only 41 years old.
To Australians in the know, Prof. Ed Holmes is known as 'sweaty Eddie.'
Sir was on TV multiple times in 2020 discussing the origins of covid, looking like someone was holding a gun to his head off screen sweating profusely. It's not about your emails, and it is definitely not about science. It's about the US DOD, the ADF, WHO and the CCP. He has been given his instructions. Tread lightly.
Edit: Hope that answers your question about why he told you to FO and why no one in China will contact you.
Thank you for this very important work! Can you lay out, perhaps here or perhaps in an article of its own, a walk through for lay people on this issue? Have you done that in a past piece? Similarly, can you lay out the scenario of what the assembly assembled, if it was NOT a new virus? Another questions, the CEO of Illumina is on record saying "his team" was flown into China to do the first sequence. Thoughts on that?
What if this sequence can be created in people by an external delivery vector, for example via air, food, water, or EMF?
Combine this with using lower or higher PCR-cycles, and it would be trivial to dial up or down the number of positive PCR-cases, according to the need.
I recently looked at the mouse study they did with mutated mice that express ace2. They used stock covid to infect them. I guess you'd like to see that repeated with a synthetic version? I'd like to know what was in the 'stock covid' they used. What is depressing about that study is they mention these mutated mice could be used to assess early treatment of antivirals. I'm not sure such studies were ever done...not that I'd know how to search for them.
If this sequence only exists in silco, does it have to make sense? I have yet to see any compelling evidence sars-cov2 actually exists, and having just a genomic sequence really proves nothing IMO. These liars can take any old snippets from GenBank or wherever, combine them in silico, and claim it is this or that, but without an actual sample from an infected patient, there is no proof of this alleged virus.
I'm not sure who the man is, or when this event was, but I have a copy of a video clip from some WEF conference and the exact quote from this man is:
'Moderna has never had a live virus in their sight, it was all a software problem'.
link to video:
https://video.twimg.com/amplify_video/1634540155016019971/vid/504x276/Uv3k8zoOZrtQ8Wfd.mp4?tag=16
And many others have publicly stated similar. I'm not sure how many of these people can keep saying they never had an actual virus before people start believing that they never had an actual virus.
1. You wrote: "Even when trimming off the leading three or four nucleotides from the reads, Megahit still assembles de-novo the head with two extra G bases at the head!"
However I was able to get rid of the two extra G bases when I trimmed the reads with `fastp -f 5 -t 5`, which removes the first 5 and last 5 bases from both forward and reverse reads. Then my longest MEGAHIT contig was 29,870 bases long, and it was otherwise identical to Wuhan-Hu-1 except it was missing the entire poly(A) tail.
There's 25 forward reads which match the first 20 bases of Wuhan-Hu-1 but with two extra G bases added to the start: `seqkit locate -p GGATTAAAGGTTTATACCTTCC SRR10971381_1.fastq`. But in all reads except a single read, the match is on the minus strand so the extra G bases at the start are actually extra C bases at the end of the read. (The forward reads are sense for cDNA and therefore antisense for RNA, so they're what people would intuitively think of as the reverse reads.)
2. You wrote: "No one, to this date, was able to perfectly reproduce MN908947.3 with Megahit or any other assembler, even when trimming the alleged adaptors, we still end up with two (or three) leading G's and a missing tail." But I figured out how to get rid of the leading G bases. And the full poly(A) tail is not included in the metagenomic reads, and Wu et al. wrote that they sequenced the ends of the genome with RACE (rapid amplification of cDNA ends).
Three years ago when the WIV published the second version of RaTG13 which had an extra 15 bases inserted to the 5' end, Steven Quay was saying that that the genome was somehow fake because the extra 15 bases were not included in the metagenomic reads at the SRA (https://twitter.com/quay_dr/status/1318041151211884552). However next year the RACE sequences of RaTG13 were published at the SRA, and they included the extra 15 bases that were missing from the metagenomic reads (https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=606165). So the reason why the genome of RaTG13 was updated may have been that the ends of the genome were sequenced with RACE, and the current version of RaTG13 cannot be reproduced by assembling the original metagenomic reads either.
3. You wrote: "Also, one can tell that the adaptors were probably trimmed, from the way that there are several reads which match the Illumina TruSeq single index adaptors apart from one or two errors. So the errors probably prevented the adaptors from getting trimmed."
More specifically you can find a couple of those reads like this: `printf %s\\n \>adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \>adapter2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT>adapter.fa;bowtie2-build adapter.fa{};bowtie2 -p4 --local --no-unal -x adapter.fa <(seqkit head -n100000 SRR10971381_1.fastq)|grep -v ^@|cut -f1,10|seqkit tab2fx|cat - adapter.fa|mafft --clustalout -`.
4. In your screenshot of the nanopore reads, the reason why the reads have a bunch of N bases and no T bases is that you didn't replace U bases with T bases (for example by running `seqkit seq --rna2dna`). And I don't know why, but a bunch of your reads seem to match the reference but their alignment is just off by about 1-20 bases. The same thing didn't happen to me when I aligned the reads with minimap2: `minimap2 -a --sam-hit-only sars2.fa <(seqkit seq --rna2dna VeroInf24h.all.fastq.zst)|samtools sort -@2 ->nano.bam`.
5. Fast Eddie wrote: "As for the publishing unfiltered reads, there are important ethical issues about realising human DNA. Not my call to make." And in another email he wrote: "Can I also say that I am completely against the raw reads being published as this would be totally unethical. The majority of these reads would be human DNA and it would be a serious breach of ethics for these to be published without the consent of the patient in question, particularly the identity of that patient is now widely known."
Last year some no-virus people were wondering how come half of the reads consisted of only N bases, but it's probably because human reads were masked like Eddie said. The SRA's website says: "Human metagenomic studies may contain human sequences and require that the donor provide consent to archive their data in an unprotected database. If you would like to archive human metagenomic sequences in the public SRA database please contact the SRA and we will screen and remove human sequence contaminants from your submission." (https://www.ncbi.nlm.nih.gov/sra/docs/submit/) The NCBI has a tool called sra-human-scrubber which is used to mask human reads with N bases in SRA submissions (https://ncbiinsights.ncbi.nlm.nih.gov/2023/02/02/scrubbing-human-sequences-sra-submissions/).
Wu et al. also wrote that they had a total of 56,565,928 reads out of which 23,712,657 were non-human reads.
6. You wrote: "How many virions were in the original sample? Surely, if the patient should have died from it, it must've been thousands or even more?" But I don't think the patient in the Wu et al. paper died from COVID, or at least the paper didn't say that he died, and he was only 41 years old.